sf cell line nucleofector solution (Lonza)

Lonza is a verified supplier

Lonza manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Lonza sf cell line nucleofector solution
Sf Cell Line Nucleofector Solution, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sf+cell+line+nucleofector+solution/4d+nucleofector/pmc12122680-176-28-39
Average 90 stars, based on 1 article reviews

sf cell line nucleofector solution - by Bioz Stars, 2026-09

90/100 stars

Images

Virus:

Article Title: Mammalian SWI/SNF complex activity regulates POU2F3 and constitutes a targetable dependency in small cell lung cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER IRDye 800CW Goat anti-Rabbit IgG Secondary Antibody LI-COR Biosciences Cat# 926–32211, RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG Secondary Antibody LI-COR Biosciences Cat#926–68070, RRID: AB_10956588 IRDye 680RD Donkey anti-Goat IgG Secondary Antibody LI-COR Biosciences Cat# 926–68074, RRID: AB_10956736 Bacterial and virus strains HB101 Promega Cat#L2011 Biological samples Patient Derived Xenografts (PDXs) Choudhuri et al., Cancer Discov., 2024 phs003486.v1.p1 Chemicals, peptides, and recombinant proteins BVdU Chem-Impex International Inc Cat #27735, CAS # 69304-47-8 FHD-609 Jun Qi’s Laboratory N/A FHD-286 Jun Qi’s Laboratory N/A AU-15330 Jun Qi’s Laboratory N/A dTAG-V1 Jun Qi’s Laboratory N/A XHC-640 Novartis N/A WA-68-VQ71 Novartis N/A dBRD9A Novartis N/A BRM014 Novartis N/A Cisplatin Fresenius Kabi Cat #100365 Etoposide Hikma Pharmaceuticals USA Cat #0143-9376-01 HP-b-CD Sigma Aldrich Cat #778966 Puromycin Gold BioTechnology Cat #P-600-100, CAS #58-58-2 G418 Gold BioTechnology Cat #G-418-10-SPO, CAS #108321-42-2 Blasticidin Thermo Fisher Scientific Cat #NC9016621 DMSO Sigma Aldrich Cat #D2650 TRIzol Reagent Thermo Fisher Scientific Cat #15596018 Tn5 transposase Illumina Cat #20034198 AMPure XP Beads Beckman Coulter Cat #A6388 Dynabeads M-280 Sheep Anti-Mouse IgG Thermo Fisher Scientific Cat #11201D Dynabeads M-280 Sheep Anti-Rabbit IgG Thermo Fisher Scientific Cat #11204D Critical commercial assays KOD HOT START DNA POLYMERASE Fisher Scientific Cat #710863 In-Fusion 5X HD Cloning Plus Takara Bio Cat #638909 NucleoSpin PCR Clean-up kit Macherey-Nagel Cat #740609.10 SF Cell Line Nucleofector Solution Lonza V4XC-2032 Genomic DNA maxi prep kit Qiagen Cat #51194 TURBO DNA-free Kit Thermo Fisher Scientific Cat #AM1907 BCA Protein Assay Kit Thermo Fisher Scientific Cat #23225 Protein Assay Dye Reagent Bio-Rad Laboratories Cat #5000006 Protease inhibitor cocktail (Complete) Roche Applied Science Cat #11836153001 phosphatase inhibitors (PhosSTOP) Sigma Aldrich Cat #04906837001 Immobilon detection reagents Thermo Fisher Scientific Cat #WBKLS0500 Supersignal West Pico Thermo Fisher Scientific Cat #PI34078 RNeasy mini kit Qiagen Cat #74106 NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs Cat #E7760L NEBNext Ultra II DNA Library Prep Kit for Illumina New England Biolabs Cat #E7645L (Continued on next page) Cancer Cell 42, 1352–1369.e1–e13, August 12, 2024 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER MinElute Reaction Cleanup Kit Qiagen Cat #28204 Quick-RNA Miniprep kit Zymo Research Cat #1159U79 iScript Reverse Transcription Supermix Bio-Rad Laboratories Cat #1708841 LightCycler 480 Probes Master Kit Roche Cat #507203179 High Sensitivity D1000 ScreenTape Agilent Cat #5067-5584 High Sensitivity D1000 ScreenTape Agilent Cat #5067-5585 High Sensitivity D5000 ScreenTape Agilent Cat #5067-5592 High Sensitivity D5000 ScreenTape Agilent Cat #5067-5593 Deposited data Human POU2F3 RNA-seq Analyses from publicly available RNA-seq Data George et al.4; Liu et al.47 GEO: GSE69091 GSA database: HRA003419 RNA-seq data of cells treated with BRM014 and WA-68-VQ71 GEO Database GEO: GSE249258 RNA-seq data of cells treated with FHD-609 and FHD-286 GEO Database GEO: GSE249362 ATAC- and ChIP-sequencing data GEO Database GEO: GSE249362 Experimental Models: Cell Lines NCI-H1048 American Type Culture Collection (ATCC) RRID: CVCL_1453 NCI-H526 American Type Culture Collection (ATCC) RRID: CVCL_1569 NCI-H211 American Type Culture Collection (ATCC) RRID: CVCL_1529 COR-L311 American Type Culture Collection (ATCC) RRID: CVCL_2412 NCI-1092 American Type Culture Collection (ATCC) RRID: CVCL_1454 NCI-H1836 American Type Culture Collection (ATCC) RRID: CVCL_1498 LU135 American Type Culture Collection (ATCC) RRID: CVCL_1389 293T American Type Culture Collection (ATCC) RRID: CVCL_0063

Derivative Assay:

Recombinant:

Cloning:

Polymerase Chain Reaction:

Bicinchoninic Acid Protein Assay:

Protease Inhibitor:

Incubation:

Article Title: Epigenetic and Oncogenic Inhibitors Cooperatively Drive Differentiation and Kill KRAS - Mutant Colorectal Cancers
Article Snippet: The mix was cooled down to room temperature on the benchtop for 10 minutes before adding 2 μL of Alt-R S.p.Cas9 Nuclease V3 (IDT, #1081059) and 5 μL of 100 μmol/L single-stranded donor oligonucleotide (5′GCTGAGGGGGCAGTCCAGTAGGCTCTGGGCAAACAGGTCAGCAGAGAGCAAGCTCCCGGGTTGGGTCACCGGCTCCCCATCCTCTGGTTGGAACACATCATCCTCCAGCTCCTCCACACACTGAGATGGCTCAGCGTAATCTGGTACGTCGTATGGGTACATCTCTCCTGTGAGGGGGCAACGCAGGCATCTGGGCTGCT-3′). .. The mix was incubated for 20 minutes at room temperature and added to 1 million LOVO and SW620 cells resuspended in 100 μL of SF Cell Line Nucleofector solution (Lonza, V4XC-2012). .. Cells were then transferred to a cuvette and nucleofected using the E0-117 program in a 4D-Nucleofector X Unit (Lonza).

Article Title: AKT and EZH2 inhibitors kill TNBCs by hijacking mechanisms of involution
Article Snippet: Cas9 Nuclease V3 (IDT, 1081059) and 5 μl of 100 μM single-stranded donor oligonucleotide (5′-GCTGAGGGGGCAGTCCAGTAGGCTCTGGGCAAACAGGTCAGCAGAGAGCAAGCTCCCGGGTTGGGTCACCGGCTCCCCATCCTCTGGTTGGAACACATCATCCTCCAGCTCCTCCACACACTGAGATGGCTCAGCGTAATCTGGTACGTCGTATGGGTACATCTCTCCTGTGAGGGGGCAACGCAGGCATCTGGGCTGCT-3′). .. The mix was incubated for 20 min at room temperature and added to 1.5 million (MDA-MB-468) or 1 million (HCC1395) cells resuspended in 100 μl of SF Cell Line Nucleofector solution (Lonza, V4XC-2012). .. Cells were then transferred to a cuvette and nucleofected using the EO-117 program in a 4D-Nucleofector X Unit (Lonza).

Multiple Displacement Amplification:

other:

Article Title: Epigenetic and oncogenic inhibitors cooperatively drive differentiation and kill KRAS-mutant colorectal cancers
Article Snippet: The mix was incubated for 20 min at room temperature and added to 1 million LOVO and SW620 cells resuspended in 100 L of SF Cell Line NucleofectorTM solution (Lonza, V4XC-2012).

Plasmid Preparation:

Article Title: Development of a 3D ex vivo model of brain-leukemia interaction to study the role of activin A in the central nervous system microenvironment
Article Snippet: .. 1 × 10 6 NALM6 cells were then nucleofected with 5 μg of pTMNDU3-IRFP670 and 2 μg of pCMV-SB11 plasmid, encoding for the SB11 transposase, in the appropriate SF Cell Line Nucleofector Solution and transferred into Amaxa certified cuvette (LONZA, Basilea, Switzerland). .. NALM6 nucleofection was performed using protocol CV-104 on the AMAXA Nucleofector 4D-X Unit platform (LONZA, Basilea, Switzerland).

Review